BGI 5128 PDF

*Exchange rate ref. BCCR. The supplier can change the price of the product. Aeropost is an online shopping services provider. Total price includes all charges . NM_c+A>G; NM_c+A>T . ss, BGI|BGI_rs, fwd/B, C/T, aatggcaaaatgataaattgtggtcttctg. ss, BGI|BGI_rs, rev/B, G/T, ctgttgagtgaaggctgtgttcttggaggg, agtattctttgaataaactgatgaattcca, 06/06/08, 06/18/09, , Genomic, unknown.

Author: Meztishicage Mikalmaran
Country: Georgia
Language: English (Spanish)
Genre: Photos
Published (Last): 4 March 2010
Pages: 337
PDF File Size: 11.11 Mb
ePub File Size: 14.51 Mb
ISBN: 801-2-57449-617-1
Downloads: 96669
Price: Free* [*Free Regsitration Required]
Uploader: Yoshakar

Sponsors of Barbados Gospelfest 2018 “Touching Lives Changing Nations”

The lined seahorse, Hippocampus erectusis an Atlantic species and big inhabits shallow sea beds or coral reefs. It has become very popular in China for its wide use in traditional Chinese medicine. In order to improve the aquaculture yield of this valuable fish species, we are trying to develop genomic resources for bi selection in genetic breeding. Here, we provide whole genome sequencing, assembly, and gene annotation of the lined seahorse, which can enrich genome resource and further application for its molecular breeding.

  LEERE NOTENZEILEN PDF

Run Accession List – DRA Search

A total of The contig N50 and scaffold N50 reached Using homology-based, de novo and transcriptome-based prediction methods, we predicted 20 protein-coding genes in the generated bg, which is less than our previously reported gene number 23 of the tiger tail seahorse H.

We report a draft genome of the lined seahorse. These generated genomic data are going to enrich genome resource of this economically important fish, and also provide insights into the genetic mechanisms of its iconic morphology and male pregnancy behavior.

Oxford University Press is a department of the University of Oxford.

It furthers the University’s objective of excellence in research, scholarship, and education by publishing worldwide. Sign In or Create an Account.

Close mobile search navigation Article navigation. Availability of supporting data.

Draft genome of the lined seahorse, Hippocampus erectus Qiang Bg. GigaScienceVolume 6, Issue 6, 1 Junegix, https: Published by Oxford University Press. Email alerts New issue alert.

  ESDU 81038 PDF

In progress issue alert. Receive exclusive offers and updates from Oxford Academic. Related articles in Web of Science Google Scholar.

Citing articles via Web of Science 2. Re analyzing community-wide datasets without major infrastructure.

Back to top